Review



il-22 primer  (PrimerDesign Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    PrimerDesign Inc il-22 primer
    Il 22 Primer, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/il-22 primer/product/PrimerDesign Inc
    Average 90 stars, based on 1 article reviews
    il-22 primer - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    specific primers il-17a, il-17f, il-22, ebi-3  (Thermo Fisher)
    90
    Thermo Fisher specific primers il-17a, il-17f, il-22, ebi-3
    Specific Primers Il 17a, Il 17f, Il 22, Ebi 3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/specific primers il-17a, il-17f, il-22, ebi-3/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    specific primers il-17a, il-17f, il-22, ebi-3 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    il-22 primer  (PrimerDesign Inc)
    90
    PrimerDesign Inc il-22 primer
    Il 22 Primer, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/il-22 primer/product/PrimerDesign Inc
    Average 90 stars, based on 1 article reviews
    il-22 primer - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    primer il-22 n/a  (Qiagen)
    90
    Qiagen primer il-22 n/a
    Primer Il 22 N/A, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer il-22 n/a/product/Qiagen
    Average 90 stars, based on 1 article reviews
    primer il-22 n/a - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    primers il-13, il-22, il-17a, t-bet, ifn-γ, il-10 18s rrna  (Qiagen)
    90
    Qiagen primers il-13, il-22, il-17a, t-bet, ifn-γ, il-10 18s rrna
    Primers Il 13, Il 22, Il 17a, T Bet, Ifn γ, Il 10 18s Rrna, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers il-13, il-22, il-17a, t-bet, ifn-γ, il-10 18s rrna/product/Qiagen
    Average 90 stars, based on 1 article reviews
    primers il-13, il-22, il-17a, t-bet, ifn-γ, il-10 18s rrna - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    primers for tnf-α, il-6, il-22, myd88, tlr2 genes  (Bioneer Corporation)
    90
    Bioneer Corporation primers for tnf-α, il-6, il-22, myd88, tlr2 genes
    Primers For Tnf α, Il 6, Il 22, Myd88, Tlr2 Genes, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers for tnf-α, il-6, il-22, myd88, tlr2 genes/product/Bioneer Corporation
    Average 90 stars, based on 1 article reviews
    primers for tnf-α, il-6, il-22, myd88, tlr2 genes - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    resource source identifier il 22 forward primer atgagtttttcccttatggggac idt  (Danaher Inc)
    86
    Danaher Inc resource source identifier il 22 forward primer atgagtttttcccttatggggac idt
    Resource Source Identifier Il 22 Forward Primer Atgagtttttcccttatggggac Idt, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/resource source identifier il 22 forward primer atgagtttttcccttatggggac idt/product/Danaher Inc
    Average 86 stars, based on 1 article reviews
    resource source identifier il 22 forward primer atgagtttttcccttatggggac idt - by Bioz Stars, 2026-03
    86/100 stars
    		  Buy from Supplier
    il-22 primer  (Sangon Biotech)
    90
    Sangon Biotech il-22 primer
    Il 22 Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/il-22 primer/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    il-22 primer - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    primers for ahr, cyp1a1 and il-22  (Qiagen)
    90
    Qiagen primers for ahr, cyp1a1 and il-22
    Primers For Ahr, Cyp1a1 And Il 22, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers for ahr, cyp1a1 and il-22/product/Qiagen
    Average 90 stars, based on 1 article reviews
    primers for ahr, cyp1a1 and il-22 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    oligonucleotide primers for hdac6, mir-22, tnf-α, il-1β, il-6, and β-actin  (Bioneer Corporation)
    90
    Bioneer Corporation oligonucleotide primers for hdac6, mir-22, tnf-α, il-1β, il-6, and β-actin
    Oligonucleotide Primers For Hdac6, Mir 22, Tnf α, Il 1β, Il 6, And β Actin, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide primers for hdac6, mir-22, tnf-α, il-1β, il-6, and β-actin/product/Bioneer Corporation
    Average 90 stars, based on 1 article reviews
    oligonucleotide primers for hdac6, mir-22, tnf-α, il-1β, il-6, and β-actin - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    predesigned primers ngal, kim-1, tnfα, il-6, il-23a, pgc-1α, il-22, endothelin  (Bio-Rad)
    90
    Bio-Rad predesigned primers ngal, kim-1, tnfα, il-6, il-23a, pgc-1α, il-22, endothelin
    Predesigned Primers Ngal, Kim 1, Tnfα, Il 6, Il 23a, Pgc 1α, Il 22, Endothelin, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/predesigned primers ngal, kim-1, tnfα, il-6, il-23a, pgc-1α, il-22, endothelin/product/Bio-Rad
    Average 90 stars, based on 1 article reviews
    predesigned primers ngal, kim-1, tnfα, il-6, il-23a, pgc-1α, il-22, endothelin - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier

    Image Search Results